How to convert text file (.txt) to .fasta

How to convert text file (.txt) to .fasta? a) Regular method b) Using

The Correct Answer and Explanation is:

To convert a .txt file to a .fasta file, you can use either a manual method or automate the process using Python. Here’s how both approaches work:

a) Regular Method

1. Open your .txt file in a plain text editor such as Notepad or VS Code.
2. Ensure the content follows the FASTA format. This means:
   • The first line must begin with a greater-than symbol (>) followed by a sequence identifier or description.
   • The next lines contain the nucleotide or protein sequence without any numbers or special characters.
3. Save the file with a .fasta extension instead of .txt.

Example:

>sequence_1
ATGCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGC

b) Using Python

You can automate the conversion using a simple Python script:

python

# Read from a .txt file and write to a .fasta file
with open("input.txt", "r") as txt_file:
    sequence = txt_file.read().strip()

with open("output.fasta", "w") as fasta_file:
    fasta_file.write(">sequence_1\n")
    fasta_file.write(sequence + "\n")

Explanation

The FASTA format is a standard text-based format for representing nucleotide or protein sequences. It is widely used in bioinformatics tools and databases. Each entry in a FASTA file begins with a single-line description that starts with a greater-than symbol, followed by lines of sequence data. This format is simple yet powerful because it allows for easy parsing and compatibility with many sequence analysis tools.

When converting a .txt file to .fasta, the key requirement is to ensure that the content adheres to the FASTA structure. If the .txt file already contains sequence data, you only need to prepend a proper header line and save the file with the .fasta extension. This manual method is suitable for small datasets or quick edits.

For larger datasets or repetitive tasks, using Python provides a more efficient and error-free approach. The script reads the sequence from the .txt file, removes any leading or trailing whitespace, and writes it to a new file with the correct FASTA header. This method ensures consistency and can be extended to handle multiple sequences or validate input formats.

Understanding how to convert between formats is essential for working with biological data, especially when preparing inputs for alignment tools, genome browsers, or sequence databases. Whether done manually or programmatically, the goal is to maintain the integrity and readability of the sequence data.